Review



primescript high fidelity reverse transcriptase kit  (TaKaRa)


Bioz Verified Symbol TaKaRa is a verified supplier
Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 97
      Buy from Supplier

    Structured Review

    TaKaRa primescript high fidelity reverse transcriptase kit
    Primescript High Fidelity Reverse Transcriptase Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 4919 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primescript+high+fidelity+reverse+transcriptase+kit/PrimeScript+Reverse+Transcriptase/pm25249323-308-11-17
    Average 97 stars, based on 4919 article reviews
    primescript high fidelity reverse transcriptase kit - by Bioz Stars, 2026-09
    97/100 stars

    Images

    Related Articles

    Reverse Transcription:

    Article Title: ATR/Chk1/Smurf1 pathway determines cell fate after DNA damage by controlling RhoB abundance.
    Article Snippet: Total RNAs were extracted from cells or tissue samples using Trizol reagent (Invitrogen) according to the manufacturer’s instructions. .. Reverse transcription was performed with 500 ng of total RNA using PrimeScript High Fidelity Reverse Transcriptase kit (Takara, Dalian, China). .. Real-time amplification of transcripts was performed using a Mastercycler EP gradient S RealPlex2 (Eppendorf, Hamburg, Germany).

    Article Title: PKA/Smurf1 signaling-mediated stabilization of Nur77 is required for anticancer drug cisplatin-induced apoptosis.
    Article Snippet: HEK293T cells were transiently transfected using the calcium phosphate method as previously described.47 Recombinant lentivirus was generated by the ViraPower Lentiviral Expression System (Invitrogen) and was used to infect HeLa cells for shRNA or protein expression. .. Quantitative RT–PCR Total RNA was extracted from cells using Trizol (Invitrogen), and complementary DNA was synthesized using PrimeScript High Fidelity Reverse Transcriptase kit (TaKaRa, Dalian, China). .. Real-time amplification of transcripts was performed using a Mastercycler EP gradient S RealPlex2 (Eppendorf, Hamburg, Germany).

    Quantitative RT-PCR:

    Article Title: PKA/Smurf1 signaling-mediated stabilization of Nur77 is required for anticancer drug cisplatin-induced apoptosis.
    Article Snippet: HEK293T cells were transiently transfected using the calcium phosphate method as previously described.47 Recombinant lentivirus was generated by the ViraPower Lentiviral Expression System (Invitrogen) and was used to infect HeLa cells for shRNA or protein expression. .. Quantitative RT–PCR Total RNA was extracted from cells using Trizol (Invitrogen), and complementary DNA was synthesized using PrimeScript High Fidelity Reverse Transcriptase kit (TaKaRa, Dalian, China). .. Real-time amplification of transcripts was performed using a Mastercycler EP gradient S RealPlex2 (Eppendorf, Hamburg, Germany).

    Synthesized:

    Article Title: PKA/Smurf1 signaling-mediated stabilization of Nur77 is required for anticancer drug cisplatin-induced apoptosis.
    Article Snippet: HEK293T cells were transiently transfected using the calcium phosphate method as previously described.47 Recombinant lentivirus was generated by the ViraPower Lentiviral Expression System (Invitrogen) and was used to infect HeLa cells for shRNA or protein expression. .. Quantitative RT–PCR Total RNA was extracted from cells using Trizol (Invitrogen), and complementary DNA was synthesized using PrimeScript High Fidelity Reverse Transcriptase kit (TaKaRa, Dalian, China). .. Real-time amplification of transcripts was performed using a Mastercycler EP gradient S RealPlex2 (Eppendorf, Hamburg, Germany).



    Similar Products

    primescript high fidelity reverse transcriptase kit  (TaKaRa)
    97
    TaKaRa primescript high fidelity reverse transcriptase kit
    Primescript High Fidelity Reverse Transcriptase Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primescript+high+fidelity+reverse+transcriptase+kit/PrimeScript+Reverse+Transcriptase/pm25249323-308-11-17
    Average 97 stars, based on 1 article reviews
    primescript high fidelity reverse transcriptase kit - by Bioz Stars, 2026-09
    97/100 stars
    		  Buy from Supplier
    prime script ii high fidelity reverse transcriptase polymerase chain reaction rt pcr kit  (TaKaRa)
    96
    TaKaRa prime script ii high fidelity reverse transcriptase polymerase chain reaction rt pcr kit
    Fibronectin deposition on the surface of gelatin material after co‐culture of MSCs and SCs. ECM accumulation is significant in gelatin sponge (GS) in the MSCs group (A), as evidenced by the rough surface (inset in A), while the surface of GS without MSCs is smooth (inset in B). FN, secreted by GFP positive MSCs (arrowheads in C), deposits onto the surface of gelatin material and displays thread‐like red fluorescence (arrows in C). Application of FN antibody decreases the deposition of FN onto the surface of gelatin material. Three dimensional reconstructive image shows that the surface of gelatin material is decorated by adherent FN (blue, in D). After adding FN blocking antibody (FNab) to the culture medium, deposition of FN (blue) onto the surface is obviously reduced as shown in (E). Green cells in D and E are MSCs. <t>RT‐PCR</t> and Western blot results indicate that, although the transcriptional level of FN decreases with the increase in duration of co‐culture (F), the amount of FN protein increases within the gelatin sponge (GS) scaffolds (G,H). Scale bars: 200 μm in (A,B), 20 μm in the inset of (A,B), and 20 μm in (C–E).
    Prime Script Ii High Fidelity Reverse Transcriptase Polymerase Chain Reaction Rt Pcr Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primescript+high+fidelity+reverse+transcriptase+kit/PrimeScript+High+Fidelity+RT-PCR+Kit/pmc05101622-85-11-22
    Average 96 stars, based on 1 article reviews
    prime script ii high fidelity reverse transcriptase polymerase chain reaction rt pcr kit - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier

    Image Search Results


    Fibronectin deposition on the surface of gelatin material after co‐culture of MSCs and SCs. ECM accumulation is significant in gelatin sponge (GS) in the MSCs group (A), as evidenced by the rough surface (inset in A), while the surface of GS without MSCs is smooth (inset in B). FN, secreted by GFP positive MSCs (arrowheads in C), deposits onto the surface of gelatin material and displays thread‐like red fluorescence (arrows in C). Application of FN antibody decreases the deposition of FN onto the surface of gelatin material. Three dimensional reconstructive image shows that the surface of gelatin material is decorated by adherent FN (blue, in D). After adding FN blocking antibody (FNab) to the culture medium, deposition of FN (blue) onto the surface is obviously reduced as shown in (E). Green cells in D and E are MSCs. RT‐PCR and Western blot results indicate that, although the transcriptional level of FN decreases with the increase in duration of co‐culture (F), the amount of FN protein increases within the gelatin sponge (GS) scaffolds (G,H). Scale bars: 200 μm in (A,B), 20 μm in the inset of (A,B), and 20 μm in (C–E).

    Journal: Journal of Biomedical Materials Research. Part a

    Article Title: Autocrine fibronectin from differentiating mesenchymal stem cells induces the neurite elongation in vitro and promotes nerve fiber regeneration in transected spinal cord injury

    doi: 10.1002/jbm.a.35720

    Figure Lengend Snippet: Fibronectin deposition on the surface of gelatin material after co‐culture of MSCs and SCs. ECM accumulation is significant in gelatin sponge (GS) in the MSCs group (A), as evidenced by the rough surface (inset in A), while the surface of GS without MSCs is smooth (inset in B). FN, secreted by GFP positive MSCs (arrowheads in C), deposits onto the surface of gelatin material and displays thread‐like red fluorescence (arrows in C). Application of FN antibody decreases the deposition of FN onto the surface of gelatin material. Three dimensional reconstructive image shows that the surface of gelatin material is decorated by adherent FN (blue, in D). After adding FN blocking antibody (FNab) to the culture medium, deposition of FN (blue) onto the surface is obviously reduced as shown in (E). Green cells in D and E are MSCs. RT‐PCR and Western blot results indicate that, although the transcriptional level of FN decreases with the increase in duration of co‐culture (F), the amount of FN protein increases within the gelatin sponge (GS) scaffolds (G,H). Scale bars: 200 μm in (A,B), 20 μm in the inset of (A,B), and 20 μm in (C–E).

    Article Snippet: Then, using each synthesized cDNA as a mould, PCR by using Prime Script II High Fidelity Reverse transcriptase‐polymerase chain reaction (RT‐PCR) Kit (Takara) was per formed with the FN primers with Forward strand: 5′‐GGCTCAATCCAAATGCCTCTAC‐3′ and Reverse strand: 5′‐CCCTCTGGTAAGGCCAGTCAG‐3′, while β‐actin with Forward strand: 5′‐AGAGGGAAATCGTGCGTGAC‐3′ and Reverse strand: 5′‐AGAGGTCTTTACGGATGTCAACG‐3′ as loading reference.

    Techniques: Co-Culture Assay, Fluorescence, Blocking Assay, Reverse Transcription Polymerase Chain Reaction, Western Blot